| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.110998 |
| Chromosome: | chromosome 2 |
| Location: | 5793578 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g110800 | NRT2F | Nitrate/nitrite transporter; (1 of 4) K02575 - MFS transporter, NNP family, nitrate/nitrite transporter (NRT, narK, nrtP, nasA) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAAAAGAGTAACGGTCACGGCCTGCCACC |
| Internal bar code: | GCTCCTCGCCGGAAATCAACTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 561 |
| LEAP-Seq percent confirming: | 99.1573 |
| LEAP-Seq n confirming: | 353 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCTCACAGGAGCGATGATG |
| Suggested primer 2: | TCACCTTCGTCAGCTCCTTT |