| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.111031 |
| Chromosome: | chromosome 17 |
| Location: | 829689 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g702150 | TRX20,HCF164,CCS5 | (1 of 1) PTHR10438//PTHR10438:SF272 - THIOREDOXIN // THIOREDOXIN-LIKE PROTEIN HCF164, CHLOROPLASTIC; Thioredoxin-like protein similar to Arabidopsis HCF164 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAGGTATGCAGCCCACGCTGCCCACTTGC |
| Internal bar code: | GGGATGGTTGGGGTCCCGTACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 186 |
| LEAP-Seq percent confirming: | 99.8881 |
| LEAP-Seq n confirming: | 1786 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCCATGCTGTACCGTATCT |
| Suggested primer 2: | GAGGTTGTTACACCGGCAGT |