Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.111037 |
Chromosome: | chromosome 13 |
Location: | 5097906 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g607300 | FAP352,MAPK5 | (1 of 1) K08293 - mitogen-activated protein kinase [EC:2.7.11.24] (E2.7.11.24); Flagellar Associated Protein 352 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCGACAACACCAAGTACACAGTCAGCGA |
Internal bar code: | ACCGGCCGCCCTGTGGAGCCAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 386 |
LEAP-Seq percent confirming: | 98.8525 |
LEAP-Seq n confirming: | 603 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AATACCTGTTGTGCTTGGGC |
Suggested primer 2: | CTGCTGTAGTGCGTGTTGGT |