| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.111074 |
| Chromosome: | chromosome 7 |
| Location: | 3400031 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g335200 | GBA1,EFG12 | (1 of 1) PTHR23115//PTHR23115:SF165 - TRANSLATION FACTOR // TYPA-LIKE TRANSLATION ELONGATION FACTOR SVR3-RELATED; Putative chloroplast TypA translation elongation GTPase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCCGCGGTACTCTGCACCTGGGTATCCTC |
| Internal bar code: | CGGGCACTATGGGGGATCTCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 506 |
| LEAP-Seq percent confirming: | 99.708 |
| LEAP-Seq n confirming: | 5464 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGGCGATACGGAACTTGAT |
| Suggested primer 2: | GGCGGCTAGAGTCACTAACG |