| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.111103 |
| Chromosome: | chromosome 16 |
| Location: | 3862691 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g689950 | (1 of 1) PF00168//PF08372 - C2 domain (C2) // Plant phosphoribosyltransferase C-terminal (PRT_C) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTCAGTGAGTCTGCGGAGGCCGGGGCTGG |
| Internal bar code: | AAGTAAGGTCGATCGCGGCTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 408 |
| LEAP-Seq percent confirming: | 93.3011 |
| LEAP-Seq n confirming: | 3092 |
| LEAP-Seq n nonconfirming: | 222 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTTTGCACCGTATGCCTTT |
| Suggested primer 2: | GGCTATGCCATCGCTAGAAG |