| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.111116 |
| Chromosome: | chromosome 16 |
| Location: | 3747260 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g689150 | SQD3,GTR23 | Sulfoquinovosyldiacylglycerol synthase; (1 of 2) K06119 - sulfoquinovosyltransferase (SQD2) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGGTCTCGCTGGGCATTACGAACACGTCC |
| Internal bar code: | GAGTGTTCTTGTAAGTAATAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 350 |
| LEAP-Seq percent confirming: | 99.8441 |
| LEAP-Seq n confirming: | 10885 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGAACCCTTCATACCGCTG |
| Suggested primer 2: | GCAGGCTTCGTACGGTACTC |