| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.111219 |
| Chromosome: | chromosome 12 |
| Location: | 6534069 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g538950 | (1 of 1) PF16455 - Ubiquitin-binding domain (UBD) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGGCAGCAAATCACCTTGCCTCGTCCATT |
| Internal bar code: | GGCTGTCGACATACCCGGTTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 668 |
| LEAP-Seq percent confirming: | 98.9565 |
| LEAP-Seq n confirming: | 3319 |
| LEAP-Seq n nonconfirming: | 35 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTAGCGACCTGGCGATCTA |
| Suggested primer 2: | TACCTCCATACTCTCGCGCT |