Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.111262 |
Chromosome: | chromosome 11 |
Location: | 133097 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g467540 | GOX7,GOX12 | (1 of 20) PTHR32208//PTHR32208:SF21 - FAMILY NOT NAMED // F10A5.18; Glyoxal oxidase 7 | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTCCAATGCCCAGCGCGGGCCTGCTGCT |
Internal bar code: | ACGTAGGACCACTCGGACGGCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 294 |
LEAP-Seq percent confirming: | 97.1995 |
LEAP-Seq n confirming: | 1666 |
LEAP-Seq n nonconfirming: | 48 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTACGAGCCAACAAGGCTTC |
Suggested primer 2: | TAAAATCCCAATTAGCCCCC |