| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.111324 |
| Chromosome: | chromosome 16 |
| Location: | 2059049 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g657250 | GOX17,GOX19 | Glyoxal oxidase 19; (1 of 12) 1.1.3.9 - Galactose oxidase / Beta-galactose oxidase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCTGGTCAGCTCAAATTTTGTGGACGTCC |
| Internal bar code: | CGGCAAATCCAAAATCAGGCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 751 |
| LEAP-Seq percent confirming: | 80.9211 |
| LEAP-Seq n confirming: | 123 |
| LEAP-Seq n nonconfirming: | 29 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGTTGTTGTCCCTTCTAGC |
| Suggested primer 2: | CCGCGTACAGATTCTGGATT |