| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.111328 |
| Chromosome: | chromosome 2 |
| Location: | 530008 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g077150 | CPLD14 | Conserved in the Plant Lineage and Diatoms; (1 of 2) PF05684 - Protein of unknown function (DUF819) (DUF819) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGTAGACTGGTCGGGTTGAACTTGTAAAC |
| Internal bar code: | CCCGCTATCTGTCCTCGCGAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 638 |
| LEAP-Seq percent confirming: | 96.9213 |
| LEAP-Seq n confirming: | 5163 |
| LEAP-Seq n nonconfirming: | 164 |
| LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGAAAATCTGCAAACGTGGG |
| Suggested primer 2: | GTATCCGATGTACGGGATGG |