| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.111395 |
| Chromosome: | chromosome 9 |
| Location: | 4252098 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g394510 | (1 of 1) IPR002044//IPR010989//IPR013784 - Carbohydrate binding module family 20 // t-SNARE // Carbohydrate-binding-like fold | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAGACGTAGTTTATTACCACTGTCAAAA |
| Internal bar code: | TGGGCGGTCCGCAATGCTGCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 519 |
| LEAP-Seq percent confirming: | 99.8464 |
| LEAP-Seq n confirming: | 5201 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAGTTGGTGGTTTCTGGTT |
| Suggested primer 2: | CCCTTCCTTAGTTGCTGCTG |