Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.111454 |
Chromosome: | chromosome 17 |
Location: | 3061886 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g720750 | TRF4 | (1 of 3) K03514 - non-canonical poly(A) RNA polymerase PAPD5/7 (PAPD5_7, TRF4); Class-II RNA nucleotidyl transferase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCGTGGCCGGGAGGCCCCCGTGGAGGCGG |
Internal bar code: | GGGTTTGACTCGATCGATTGTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 124 |
LEAP-Seq percent confirming: | 40.0 |
LEAP-Seq n confirming: | 4 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTTGTCCCTGTTGTTTCCA |
Suggested primer 2: | TAGCCTCTCGCGGTACTCAT |