| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.111481 |
| Chromosome: | chromosome 4 |
| Location: | 2077416 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g219150 | (1 of 14) IPR006626//IPR011050 - Parallel beta-helix repeat // Pectin lyase fold/virulence factor | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGATGTCGGTGAGGCTGGGCCGGTCGTCC |
| Internal bar code: | GGCTTCTGGGGCTTAAAACACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 508 |
| LEAP-Seq percent confirming: | 99.8603 |
| LEAP-Seq n confirming: | 715 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGACTACCACCTGCTGTTT |
| Suggested primer 2: | AGTTGCCGTAGGTGGTGAAC |