| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.111503 |
| Chromosome: | chromosome 17 |
| Location: | 1658120 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g708250 | ARL8 | (1 of 1) K07955 - ADP-ribosylation factor-like protein 8 (ARL8); ARF-like GTPase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAACCTGTAGTACCGCCAGGACATAGGGT |
| Internal bar code: | TTTAGCATCATCACCAAAACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 285 |
| LEAP-Seq percent confirming: | 98.2199 |
| LEAP-Seq n confirming: | 938 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCACAGCCGGTAACAAAGAT |
| Suggested primer 2: | GGTCATTTTCCGCACTGTTT |