Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.111525 |
Chromosome: | chromosome 4 |
Location: | 3174075 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g226150 | AOC1 | (1 of 4) PTHR11785:SF367 - AMINO-ACID PERMEASE BAT1; Amino acid carrier | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTTAGATTGGCCTCTATGTAGGTTAAATG |
Internal bar code: | TAGTGCGTGTTGGTGGTTTACG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 567 |
LEAP-Seq percent confirming: | 99.1016 |
LEAP-Seq n confirming: | 3971 |
LEAP-Seq n nonconfirming: | 36 |
LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGCCACAGCTTGACTTCATC |
Suggested primer 2: | TTGTCCAGGAACATCACCAA |