| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.111709 |
| Chromosome: | chromosome 6 |
| Location: | 3809501 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278166 | PRL4 | Predicted extracellular protein; (1 of 1) PTHR10334:SF165 - PATHOGENESIS-RELATED PROTEIN-RELATED | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCAGTCGTAGTTGCAGATCTCGTTTGCCC |
| Internal bar code: | GCGTCAGACTTGTACAATCTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 707 |
| LEAP-Seq percent confirming: | 99.0783 |
| LEAP-Seq n confirming: | 6020 |
| LEAP-Seq n nonconfirming: | 56 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTTCCAGCAGCAACCTAAC |
| Suggested primer 2: | GCTTACCGACCGTAGTTCCA |