| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.111731 |
| Chromosome: | chromosome 3 |
| Location: | 2283662 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g158050 | PPP11 | (1 of 1) PF00686//PF07228 - Starch binding domain (CBM_20) // Stage II sporulation protein E (SpoIIE) (SpoIIE); Phosphoprotein phosphatase 2C-related | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACGAAGCGCGCGTGCGAGTCTATTGCCAC |
| Internal bar code: | CCAAATCGGCCAGCAGCGGTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 678 |
| LEAP-Seq percent confirming: | 93.5022 |
| LEAP-Seq n confirming: | 6274 |
| LEAP-Seq n nonconfirming: | 436 |
| LEAP-Seq n unique pos: | 51 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGACGATGAGATCGAGCAG |
| Suggested primer 2: | GACCAGCGGAACTTTGTAGC |