Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.111740 |
Chromosome: | chromosome 2 |
Location: | 2510297 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g092250 | FKB42,FKB22 | Peptidyl-prolyl cis-trans isomerase, FKBP-type; (1 of 2) PF00254//PF07719//PF13414 - FKBP-type peptidyl-prolyl cis-trans isomerase (FKBP_C) // Tetratricopeptide repeat (TPR_2) // TPR repeat (TPR_11) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTATCCCGATTGCCCCTATGCCAGACATC |
Internal bar code: | TGCTAGTACGTCGATCGGACGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 487 |
LEAP-Seq percent confirming: | 62.0491 |
LEAP-Seq n confirming: | 2907 |
LEAP-Seq n nonconfirming: | 1778 |
LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACCGAGCTAAAGAAGTCCG |
Suggested primer 2: | CGCATTCTACAAGACCAGCA |