Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.111768 |
Chromosome: | chromosome 16 |
Location: | 6995094 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g677765 | (1 of 4) PF00207 - Alpha-2-macroglobulin family (A2M) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCGGATGTGGACTGGCCCACGGACCTGGA |
Internal bar code: | TTTGAGCTCTCATATTAACATC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 802 |
LEAP-Seq percent confirming: | 99.493 |
LEAP-Seq n confirming: | 3140 |
LEAP-Seq n nonconfirming: | 16 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTGCCAGAAGACAGCATCAC |
Suggested primer 2: | GGCACACAACAAAACGTGTC |