| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.112077 |
| Chromosome: | chromosome 7 |
| Location: | 2651323 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g330600 | (1 of 2) K01510 - apyrase (ENTPD1_3_8) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACCGTAGCGGTCAAGGGCAGCGGTTCCCT |
| Internal bar code: | AGCACAAGTGCGTGGTGAGGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 330 |
| LEAP-Seq percent confirming: | 99.0488 |
| LEAP-Seq n confirming: | 3332 |
| LEAP-Seq n nonconfirming: | 32 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACATTGACCCTAACCTCCC |
| Suggested primer 2: | CGACGCATGGGAGTAAAGAT |