| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.112081 |
| Chromosome: | chromosome 13 |
| Location: | 3578189 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g588250 | (1 of 1) K16457 - centrosomal protein CEP76 (CEP76) | CDS/intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCTGGACATACTCGGCACCACCGCCGCC |
| Internal bar code: | ACTAGGTACATGGTGGCCTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1263 |
| LEAP-Seq percent confirming: | 99.4723 |
| LEAP-Seq n confirming: | 22998 |
| LEAP-Seq n nonconfirming: | 122 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTGTGTGAAATGTGCTGGG |
| Suggested primer 2: | TATAACCTCACCCCACCCAA |