| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.112108 |
| Chromosome: | chromosome 5 |
| Location: | 3377623 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g240900 | (1 of 1) IPR000001//IPR024079 - Kringle // Metallopeptidase, catalytic domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGCTCCCGCCACCCAACCTGCAGAAAGC |
| Internal bar code: | GAGTAGGTACTCTCGGGGGGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 745 |
| LEAP-Seq percent confirming: | 97.9154 |
| LEAP-Seq n confirming: | 11414 |
| LEAP-Seq n nonconfirming: | 243 |
| LEAP-Seq n unique pos: | 64 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCCGCTAAGGGTTGTGGTA |
| Suggested primer 2: | GGCTGAAGAACACCTCTTGC |