| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.112129 |
| Chromosome: | chromosome 6 |
| Location: | 7590738 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g301050 | ARL13B,ARL13 | (1 of 1) K07962 - ADP-ribosylation factor-like protein 13B (ARL13B, ARL2L1); ARF-like GTPase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAAAACCGGGATGCCAGCTGTGCCCTCGTT |
| Internal bar code: | CTAGTATGAAGCAGGTGGCTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 878 |
| LEAP-Seq percent confirming: | 98.4238 |
| LEAP-Seq n confirming: | 2685 |
| LEAP-Seq n nonconfirming: | 43 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCAACACCGCAGATAAAAT |
| Suggested primer 2: | GACCTAGGTGGTGGCAAAAA |