| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.112161 |
| Chromosome: | chromosome 5 |
| Location: | 1835963 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g242000 | CHLD,CHLD1 | (1 of 1) K03404 - magnesium chelatase subunit D (chlD, bchD); Magnesium chelatase subunit D, chloroplast precursor | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGTGGAGACCGCCGCTATCTAGGGGAGGG |
| Internal bar code: | GTCCATCAAAGTCAACAGAAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 725 |
| LEAP-Seq percent confirming: | 99.1643 |
| LEAP-Seq n confirming: | 712 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGATGAGCTGTGTAGACGA |
| Suggested primer 2: | TGTGCCTCATCCCCTTCTAC |