Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.112282 |
Chromosome: | chromosome 17 |
Location: | 2054387 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g711650 | NUD1,NUDC1,NUDC | (1 of 4) IPR007052//IPR008978 - CS domain // HSP20-like chaperone; Nuclear distribution/movement family protein | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAGCTGTCACGTCCGTAGACTTCGCACTT |
Internal bar code: | GGATGATCTAAACGTCGGAGCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 670 |
LEAP-Seq percent confirming: | 98.8518 |
LEAP-Seq n confirming: | 947 |
LEAP-Seq n nonconfirming: | 11 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCTGTCCTAGAACCCCCAT |
Suggested primer 2: | AAGCATTGTGATCTACGGGG |