| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.112477 |
| Chromosome: | chromosome 4 |
| Location: | 3710690 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g229163 | (1 of 1) PF00169//PF02181 - PH domain (PH) // Formin Homology 2 Domain (FH2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTATTTAGGGCGGGCAGGCAGGCGGACAA |
| Internal bar code: | CTGGATGAATTGGGGTACCCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 720 |
| LEAP-Seq percent confirming: | 97.6812 |
| LEAP-Seq n confirming: | 1011 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAACACCCCAAGCATTTCT |
| Suggested primer 2: | TGTGAAGAACGGAATCACCA |