Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.112479 |
Chromosome: | chromosome 12 |
Location: | 7216288 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g558400 | TRR2 | (1 of 1) K00773 - queuine tRNA-ribosyltransferase [EC:2.4.2.29] (tgt, QTRT1); Queuine tRNA-ribosyltransferase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCAGGCACACACGCGAAGCGCCGCCGAGC |
Internal bar code: | AGGGCAGGAAGGAGGGCGCACT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 856 |
LEAP-Seq percent confirming: | 99.7887 |
LEAP-Seq n confirming: | 1889 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TATGCGCTGCAGAGTTATGG |
Suggested primer 2: | CCAGAGAGCAACGAAGATCC |