| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.112624 |
| Chromosome: | chromosome 15 |
| Location: | 664127 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g637761 | ABCD1 | Peroxisomal long-chain acyl-CoA transporter, ABC superfamily; (1 of 1) K05677 - ATP-binding cassette, subfamily D (ALD), member 3 (ABCD3, PMP70) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAAGTAGCTGGAGGCGCCGCATGCTTAC |
| Internal bar code: | TATCCACTGGTCACCGTCTGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 681 |
| LEAP-Seq percent confirming: | 72.3312 |
| LEAP-Seq n confirming: | 3686 |
| LEAP-Seq n nonconfirming: | 1410 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAGGCAGTAGCTGGAGGTG |
| Suggested primer 2: | CGCTGACTTTAGGGACTTCG |