| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.112638 |
| Chromosome: | chromosome 1 |
| Location: | 2491696 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g014150 | MFT5:MAE5,MFT5,MAE5 | (1 of 11) K03327 - multidrug resistance protein, MATE family (TC.MATE, SLC47A, norM, mdtK, dinF); MATE efflux family protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTTCCTTGCTTCTGACAGCACTGCCACTT |
| Internal bar code: | GCTCTGTCAACATACCGCCAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 65 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 25 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCTGGTTTCAACTCGGCTC |
| Suggested primer 2: | TAGACAACTCATGCGCGTTC |