Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.112654 |
Chromosome: | chromosome 17 |
Location: | 7148036 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g747747 | (1 of 18) PF12906 - RING-variant domain (RINGv) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCACACGCCTGTCCGTGGGGGTGTTTGG |
Internal bar code: | GTAGCGCTTCCGCATGATGCCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 417 |
LEAP-Seq percent confirming: | 99.6629 |
LEAP-Seq n confirming: | 5026 |
LEAP-Seq n nonconfirming: | 17 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGATAGCTAGAGGTGCGGC |
Suggested primer 2: | CAACGCACGAGATTTCTTCA |