Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.112657 |
Chromosome: | chromosome 7 |
Location: | 4749598 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g345350 | (1 of 1) PTHR10641:SF483 - TRANSCRIPTION FACTOR MYB44; Myb-like transcription factor | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCGGTTCGCCGGTGGCGGGTGGGCGAGGA |
Internal bar code: | GCCTTCGGTCTGGTAGCGAGCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 891 |
LEAP-Seq percent confirming: | 98.5816 |
LEAP-Seq n confirming: | 139 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTTGTGTATGGCTGCAATGG |
Suggested primer 2: | TTCTACGCCAGCTTGTGATG |