| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.112702 |
| Chromosome: | chromosome 13 |
| Location: | 1518572 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g572750 | AMX3 | (1 of 1) 1.4.3.22 - Diamine oxidase / SSAO; Copper amine oxidase, amiloride-sensitive | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATAGATGTGTCTTTTACCGACTGTCCTAC |
| Internal bar code: | TTAAAAGTCATGTGTTCGGCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 558 |
| LEAP-Seq percent confirming: | 99.1736 |
| LEAP-Seq n confirming: | 120 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAGCTGCATGTGAGTGGAA |
| Suggested primer 2: | GTTTTGTCTTCGGCTCTTCG |