Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.112771 |
Chromosome: | chromosome 4 |
Location: | 3050445 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g225200 | FAP311 | Flagellar Associated Protein 311; (1 of 5) PF13374 - Tetratricopeptide repeat (TPR_10) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGGCCTCATTGACGTCGTACCCCAGTAC |
Internal bar code: | GTAGGAGGCAGTACTCGAGTGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 242 |
LEAP-Seq percent confirming: | 99.8289 |
LEAP-Seq n confirming: | 1750 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGAGCTCAAAGGAACAGGTC |
Suggested primer 2: | TCCCATCTCTGACCTCATCC |