| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.112799 |
| Chromosome: | chromosome 16 |
| Location: | 5983249 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g676650 | AP1G1 | Gamma1-Adaptin; (1 of 1) K12391 - AP-1 complex subunit gamma-1 (AP1G1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTAACCATGGGACGTTTGGTGAAGATGCC |
| Internal bar code: | ACTGATCGATCCGCGTTGCCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 858 |
| LEAP-Seq percent confirming: | 79.2798 |
| LEAP-Seq n confirming: | 2686 |
| LEAP-Seq n nonconfirming: | 702 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACTGCATCTCTCGACCGTG |
| Suggested primer 2: | TCGCAACTCACAAGAGGATG |