| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.112808 |
| Chromosome: | chromosome 10 |
| Location: | 2346530 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g434950 | (1 of 1) PF05010 - Transforming acidic coiled-coil-containing protein (TACC) (TACC) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGTAACCCCGGTCGGGCTGCGACGGTTC |
| Internal bar code: | ACAATAAAGGAGCATGAGACAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 980 |
| LEAP-Seq percent confirming: | 99.4786 |
| LEAP-Seq n confirming: | 954 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTTAGAGGGGCGTTTAGGG |
| Suggested primer 2: | GCAGGACACCACTGCTGTAA |