Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.112896 |
Chromosome: | chromosome 3 |
Location: | 1909082 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g155150 | (1 of 11) PF07173 - Protein of unknown function (DUF1399) (DUF1399) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTAATGCTCGATGCACGCAGCACCCCTA |
Internal bar code: | CAGCAGCTCCTATTGGCTCCGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 700 |
LEAP-Seq percent confirming: | 99.7118 |
LEAP-Seq n confirming: | 4844 |
LEAP-Seq n nonconfirming: | 14 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCTGATGAACGCACACTTG |
Suggested primer 2: | GGTATGCTGCTTGCTCATCA |