Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.112963 |
Chromosome: | chromosome 6 |
Location: | 6642259 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g294000 | CGL113 | Dienelactone hydrolase family protein; (1 of 2) K01061 - carboxymethylenebutenolidase (E3.1.1.45) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTGCCTGTGACAGTTGCGTGGGCACCGG |
Internal bar code: | GACAGGAGGGCTGGTTGTGCAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 680 |
LEAP-Seq percent confirming: | 99.6844 |
LEAP-Seq n confirming: | 6632 |
LEAP-Seq n nonconfirming: | 21 |
LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACATACTGTGAACCCCTCGC |
Suggested primer 2: | GCTTCTTGAACAGTGCCACA |