Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.112978 |
Chromosome: | chromosome 3 |
Location: | 8008600 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g201550 | MMP20 | Matrix metalloproteinase; (1 of 1) IPR000095//IPR008752 - CRIB domain // Peptidase M11, gametolysin | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGCAGTGCTGGCAAGCGTGCTAGCTAGCA |
Internal bar code: | GAGGCCAGGGGATGTGGGGTCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 615 |
LEAP-Seq percent confirming: | 99.7896 |
LEAP-Seq n confirming: | 2371 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGTGGCTCTCGTCTGTGAA |
Suggested primer 2: | ATCAAGGCCAAGACCAACAC |