| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.113174 |
| Chromosome: | chromosome 3 |
| Location: | 290450 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g144564 | MMP13 | Matrix metalloproteinase; (1 of 1) IPR008752//IPR024079 - Peptidase M11, gametolysin // Metallopeptidase, catalytic domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATTGCAAGGTTTGCGCTGCTAATCATGGT |
| Internal bar code: | ACAGACAGAATTCTTCCATGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 737 |
| LEAP-Seq percent confirming: | 99.6319 |
| LEAP-Seq n confirming: | 5954 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TATATGTGGACAGCATCGCC |
| Suggested primer 2: | GGCTCTTCTGTGTCATGCAA |