| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.113186 |
| Chromosome: | chromosome 9 |
| Location: | 4394761 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g395362 | (1 of 4) 1.13.11.75 - All-trans-8'-apo-beta-carotenal 15,15'-oxygenase / 8'-apo-beta-carotenal 15,15'-oxygenase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTCGTGTTCACTACCGTGCATTCTTCGGG |
| Internal bar code: | CCCCCGCTACGTAGCTGGAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 638 |
| LEAP-Seq percent confirming: | 99.8205 |
| LEAP-Seq n confirming: | 1668 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCTATGTCAGCGGTGGAGT |
| Suggested primer 2: | AGGTCCTGGTCAAGCTCAAA |