Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.113212 |
Chromosome: | chromosome 16 |
Location: | 5634800 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g679550 | FAP277 | Flagellar Associated Protein 277; (1 of 1) K13963 - serpin B (SERPINB) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCATGAGCATCATTTACGCACTCACGCTG |
Internal bar code: | GAAAGGCAAGGCCCCCAGCTAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 232 |
LEAP-Seq percent confirming: | 99.575 |
LEAP-Seq n confirming: | 7966 |
LEAP-Seq n nonconfirming: | 34 |
LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATGGTAAAGCCGTTGGACAG |
Suggested primer 2: | CCGTACTCACTGGTCGGTTT |