| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.113223 |
| Chromosome: | chromosome 12 |
| Location: | 5179854 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g527600 | (1 of 1) K12865 - polyglutamine-binding protein 1 (PQBP1, NPW38) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATGCACGGCCCAGCCCCGTGCTCACACAG |
| Internal bar code: | GGGAAATATGGGACAGGCGGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 390 |
| LEAP-Seq percent confirming: | 98.6528 |
| LEAP-Seq n confirming: | 2856 |
| LEAP-Seq n nonconfirming: | 39 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCACCTTCTTGTTCTTGGG |
| Suggested primer 2: | GATGGTGAGGGCACTTGTCT |