| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.113253 |
| Chromosome: | chromosome 12 |
| Location: | 4882176 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g525200 | NOP56 | (1 of 1) K14564 - nucleolar protein 56 (NOP56); Nucleolar protein, Component of C/D snoRNPs | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCAGACCCATGCTGCGGAACCCAATGTTG |
| Internal bar code: | TCAGTCGCCTCTATGTGCCTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 827 |
| LEAP-Seq percent confirming: | 97.5226 |
| LEAP-Seq n confirming: | 2913 |
| LEAP-Seq n nonconfirming: | 74 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATGCAGGGAACTTGGTTTT |
| Suggested primer 2: | CCAGAGCTATACCTGGCAGC |