Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.113264 |
Chromosome: | chromosome 3 |
Location: | 7213665 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g207800 | ADH5,CAD1 | Cinnamyl-alcohol dehydrogenase; (1 of 2) 1.1.1.195 - Cinnamyl-alcohol dehydrogenase / CAD | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAAAGACTTGATTGGCACGTGCTGGTGTT |
Internal bar code: | AGTAAGCACGACCGGCCAATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 927 |
LEAP-Seq percent confirming: | 97.6918 |
LEAP-Seq n confirming: | 3005 |
LEAP-Seq n nonconfirming: | 71 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTCGTTTCTTGCCGACTCTC |
Suggested primer 2: | TAAGCTCATGAACGCCACTG |