| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.113308 |
| Chromosome: | chromosome 17 |
| Location: | 243324 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g697934 | ATP23 | Assembly factor for F1 mitochondrial ATP synthase; (1 of 1) K18156 - mitochondrial inner membrane protease ATP23 [EC:3.4.24.-] (ATP23, XRCC6BP1) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGCCTGGTCCAAATGCCGGGACGGCCCA |
| Internal bar code: | CAGCATTCCCATGTAAGGGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 558 |
| LEAP-Seq percent confirming: | 99.8613 |
| LEAP-Seq n confirming: | 3599 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCATGAGGTATAATGGCGA |
| Suggested primer 2: | ACCAGCTGCCAGTCGTAACT |