| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.113385 |
| Chromosome: | chromosome 6 |
| Location: | 7233309 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g298100 | SUI1A,SUI1 | Translation initiation protein; (1 of 1) K03113 - translation initiation factor 1 (EIF1, SUI1) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTGCCGGCGCCGACGAGGGCAATGCCGGA |
| Internal bar code: | GTTTACCTCCGGTTCAGAGGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1126 |
| LEAP-Seq percent confirming: | 99.5402 |
| LEAP-Seq n confirming: | 12774 |
| LEAP-Seq n nonconfirming: | 59 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGTCCTTCTTCACGAGCTT |
| Suggested primer 2: | CGGAGCTGTCCTAGAACCTG |