| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.113423 |
| Chromosome: | chromosome 7 |
| Location: | 1463203 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g323450 | SMM24 | S-adenosyl-L-methionine-dependent methyltransferase; (1 of 1) 2.1.1.287 - 25S rRNA (adenine(645)-N(1))-methyltransferase / 25S rRNA m(1)A(645) methyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGTCCCAGTCCTAGTCAGAGCCCGAACCC |
| Internal bar code: | GCTTCGCTTGCTGGAGCTTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 0 |
| LEAP-Seq percent confirming: | 99.3647 |
| LEAP-Seq n confirming: | 782 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAGAAGCAGGTCAAGGAGG |
| Suggested primer 2: | GCGACCAAGACCAAAGAATC |