| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.113585 |
| Chromosome: | chromosome 6 |
| Location: | 2370156 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g267700 | SPPA1-2,SPP1B,SPP2 | Signal peptide peptidase; (1 of 1) PF00574//PF01343 - Clp protease (CLP_protease) // Peptidase family S49 (Peptidase_S49) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACGTACCTCCTAGTTTGCCCGGCTAGTCC |
| Internal bar code: | CTTCGGTCTTGTTGTAATCAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 655 |
| LEAP-Seq percent confirming: | 98.7342 |
| LEAP-Seq n confirming: | 78 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCGCCAACGAACTTATGAC |
| Suggested primer 2: | AACAGCAGTGATGCTCAACG |