| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.113597 |
| Chromosome: | chromosome 12 |
| Location: | 9053420 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g543303 | CGLD20,CGLD6 | conserved protein with COG5222 RING zinc finger domain; (1 of 1) PF08783 - DWNN domain (DWNN) | 3'UTR|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACCAGATGCCAGGCTTCCTTACTGCAAAC |
| Internal bar code: | TAGGGTATGCTGTGTTTAGTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 269 |
| LEAP-Seq percent confirming: | 85.9228 |
| LEAP-Seq n confirming: | 2826 |
| LEAP-Seq n nonconfirming: | 463 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACACACACACACTGCTTGC |
| Suggested primer 2: | ATAGAGTGGGTCATGCCAGG |