Insertion junction: LMJ.RY0402.113646_1

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:-
Strain:LMJ.RY0402.113646
Chromosome:chromosome_3
Location:5005435
Confidence (%):58
Locus disrupted Locus common name Defline Orientation Feature
Cre03.g180450 FAP215,FPN1 5\'-nucleotidase and Flagellar Associated Protein sense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):TCACCGTAGTGAACCGGAGTTGAGGATGGC
Internal bar code:GAGCTACCTTCTGGTCGGTACG

Confirmation - LEAP-Seq

LEAP-Seq distance:166
LEAP-Seq percent confirming:99.7033
LEAP-Seq n confirming:336
LEAP-Seq n nonconfirming:1
LEAP-Seq n unique pos:2

Suggested primers for confirmation by PCR

Suggested primer 1:CTCAACGTGTTGGTGTTTGG
Suggested primer 2:GACCGCCACCTTGTACTTGT